Methods Cell culture and infection The human selleck osteosarcoma cell line, SaOS2 and 293T cells were purchased from the American Type Culture Collection. Cells were grown in 5% CO2 saturated humidity, at 37°C and cultured in DMEM (Gibco, USA) supplemented with penicillin/streptomycin, 2 mmol/L glutamine and 10% FBS. Cells were subcultured at 9 × 104 cells per well into 6-well tissue culture plates. After 24 h culture, cells were infected with recombinant

lentivirus vectors at a multiplicity of infection (MOI) of 40. Design of shRNA and plasmid preparation We designed and cloned a shRNA template into a lentivirus vector previously used [5]. A third generation self-inactivating lentivirus vector pGCL-GFP learn more containing a CMV-driven GFP reporter and a U6 promoter upstream of the cloning sites. Three coding regions corresponding to targeting human COX-2 (GenBank Accession: NM 000963.2) were selected as siRNA target sequences (Table

1) under the guide of siRNA designing software offered by Genscript. We constructed three shRNA-COX-2 lentivirus vectors, namely LV-COX-2siRNA-1, LV-COX-2siRNA-2 and LV-COX-2siRNA-3, respectively. To detect the interference effects of different target, COX-2 mRNA and protein levels were determined using RT-PCR and western blotting. Recombinant lentivirus vectors and control lentivirus vector were produced by co-transfecting with the lentivirus expression plasmid and packaging plasmids

in 293T cells. Infectious lentiviruses NCT-501 were harvested 48 h post-transfection, centrifuged and filtered through 0.45 um cellulose acetate filters. The infectious titer was determined by hole-by-dilution titer assay. The virus titers produced were approximately 109 transducing u/ml medium. Table 1 Interfering sequence specified for COX-2 gene   Sequence LV-COX-2siRNA-1 Oligo1: 5′TaaACACAGTGCACTACATACTTAtcaagagTAAGTATGTAGTG CACTGTGTTTTTTTTTC3′   Oligo2: 5′TCGAGAAAAAAaaACACAGTGCACTACATACTTActcttgaTAA GTATGTAGTGCACTGTGTTTA3′ LV- COX-2siRNA-2 Oligo1: 5′TaaTCACATTTGATTGACAGTCCAtcaagagTGGACTGTCAATC AAATGTGA TTTTTTTTC3′   Oligo2: 5′TCGAGAAAAAAaaTCACATTTGATTGACAGTCCActcttgaTGG ACTGTCAATCAAATGTGATTA3′ PD184352 (CI-1040) LV- COX-2siRNA-3 Oligo1: 5′TaaCCTTCTCTAACCTCTCCTATTtcaagagAATAGGAGAGGTT AGAGAAGGTTTTTTTTC3′   Oligo2: 5′TCGAGAAAAAAaaCCTTCTCTAACCTCTCCTATTctcttgaAAT AGGAGAGGTTAGAGAAGGTTA3′ The three interfering sequence targeted for human COX-2 gene were named LV-COX-2siRNA-1, LV-COX-2siRNA-2 and LV-COX-2siRNA-3, whose coding regions were corresponding to directly at human COX-2 (NM 000963.2) starting at 352, 456 and 517, respectively. Cell proliferation assay Cell proliferation was determined by 3-(4,5-dimethylthiazole-2-yl)-2,5-diphenyltetrazolium bromide (MTT) assay.

Cell growth curve Exponentially growing normal and transformed IEC-6 cells were

cultivated in 96-well plate, with 1 × 104 cells in each well. Twelve hours later,3H-TdR 7.4 × 104Bq/ml was added into the culture media, and the plate was returned to the incubator for further cultivation. Cells were washed with cold PBS after discarding the #CB-839 molecular weight randurls[1|1|,|CHEM1|]# culture media at indicated time. Excess3H-TdR was removed by washing with 3 ml PBS. The cells were resuspended in 10% trichloroacetic acid (TCA) with vigorous vortexing. The cellular lysates were vacuum-filtered and then washed with cold 5% TCA. Incorporated3H-TdR was measured in a liquid scintillation counter (Beckman LS5000TA, Fullerton, California, USA). The procedures were performed 3

selleck chemicals llc times in duplicate 24-well culture dishes. Values are expressed as mean ± SEM. Gene expression studies using Rat Oligo GEArray A rat Oligo GEArray microarray (Exiqon, Denmark) was employed to detect altered gene expression associated with cell transformation. RNA preparation: Total RNA was isolated from the cells of each group using TriPure reagent kit according to the manufacturer’s protocol (Roche Diagnostics Co.). The integrity of RNA sample was assessed by viewing the ethidium bromide-stained 28 S and 18 S ribosomal RNA bands, and the purity of RNA sample was verified by the absorption ratio OD260 nm/OD280 nm. Equal amounts of RNA isolated from normal and transformed IEC-6 cells were pooled for Erastin in vitro the following microarray detections. 3 μg total RNA was reverse transcribed into Biotin-16-dUTP-labeled cDNA probes with the TrueLabeling-AMP method according to the manufacturer’s instructions. The microarray membranes were pre-hybridized at 60°C for at least 2 h. Hybridization of the Biotin-labeled cDNA probes to the membranes was carried out at 60°C overnight with slow agitation in a hybridization oven. The hybridized membranes were washed in saline sodium citrate buffer. Then membranes were incubated with alkaline phosphatase-conjugated streptavidin,

washed and incubated with the chemiluminescent substrate CDP-Star. Images of the membranes were acquired using the Chemidoc XRS system (Biorad Laboratories) and analyzed. The relative expression level of each gene was determined by comparing the signal intensity of each gene in the array after correction for background and normalization. microRNA chips miRCURY LNA™ microRNA chips (Exiqon, Vedbaek, Denmark) were employed to detect altered miRNA expression associated with cell transformation. The chips (version 9.2) contained totally 2056 probes, including human, mouse and rat miRNA genes, in triplicate. Total RNA (2–4 μg) was 3′-end-labeled using T4 RNA ligase and a Cy3-labeled RNA linker by the following procedure: RNA in 2.0 μL of water was combined with 1.0 μL of CIP buffer and CIP (Cat#208021, Exiqon). The mixture was incubated for 30 min at 37°C, and was terminated by incubation for 3 min at 80°C. Then 3.

After complementary DNA was synthesized with a two-step reverse

transcription reaction kit(TAKARA, Dalian, China), quantitative PCR was performed on an Applied Biosystems 7500 Real-time PCR System using SYBR Premix Ex Taq Kit (TAKARA, Dalian, China) in Axygen 96-well reaction plates following the manufacturer’s protocols. β-actin was used as a reference to obtain the relative fold change for target samples using the comparative Ct method. SHP099 cost The primers used are as follows: β-actin forward, TCACCCACACTGTGCCCATCTACGA; β-actin reverse, CAGCGGAACCGCTCATTGCCAATGG, AQP3 forward, CACAGCCGGCATCT- TTGCTA, reverse, TGGCCAGCACACACACGATA, All cell preparations and real-time PCRs were performed in triplicate. Western blot analysis For Western blot, cells were reseeded in 6-well plates at a density of 0.2 × 106 cells/ml with fresh complete culture medium. Cells with or without treatment were washed with cold PBS and harvested by scraping into 150 μl of RIPA buffer(containing 50 mM Tris-HCl, pH 7.4, 150 mM NaCl, 1% NP-40, 1 mM EDTA 0.25% sodium deoxycholate) with 1mM NaF, 10 μM Na3VO4, 1 mM PMSF, and a protease inhibitor

concoction(10 μg/ml leupeptin, 10 μg/ml aprotinin, and 1 μM pepstatin). Cell lysates were incubated at 4°C for 30 min. After centrifugation at 12,000 rpm for 20 min at 4°C, protein concentrations were determined by bicinchoninic acid(BCA) protein assay. Forty micrograms of proteins(for AQP3, check details MT1-MMP, MMP-2, MMP-9, phospho-AKT or AKT) were denatured in selleck compound 5× SDS-PAGE sample buffer for 5 min at 100°C. The proteins were separated by 12% SDS-PAGE and transferred onto PVDF membrane(Millipore, Bedford, MA) for 90 min at 4°C. Nonspecific binding was blocked with 5% Mirabegron dry skimmed milk in TBST

(20 Mm Tris-HCl, 137 mM NaCl, 0.1% Tween 20, pH 7.4) for 2 h at room temperature. After blocking, membranes were incubated with specific antibodies against AQP3(1:500), MT1-MMP(1:1,000), MMP-2(1:1,000), MMP-9(1:1,000), phospho-AKT(1:1,000), or AKT(1:1,000) in dilution buffer (2% BSA in TBS) overnight at 4°C. The blots were incubated with HRP-conjugated anti-mouse or anti-rabbit IgG (1:2,000) at room temperature for 2 h. Antibody binding was detected using an enhanced chemiluminescence(ECL) detection system following manufacturer’s instructions and visualized by autoradiography with Hyperfilm. Semiquantitatively analyzed of the blots were acquired using the software Quantity One(BioRad, USA). The density for AQP3, MMPs, or phospho-AKT protein in their parental sample was normalized to 1.0, and the values for other treatments were calculated against this value. Statistical analysis All data were expressed as mean ± SD. Statistical analyses were performed using Student’s t test or analysis of variance (ANOVA). The values of P < 0.05 are considered significant.

In this study, chemo-sensitivity induced by CLU Tozasertib solubility dmso gene silencing was directly correlated to the endogenous level of CLU protein expressed in a given cell line, being particularly enhanced in KF-TX, SKOV-3-TX, that express the highest levels of s-CLU. An experimental system in which OVK18 cells were genetically modified to specifically over-CYC202 purchase expression s-CLU rendered cells TX-resistant. Thus, in our system s-CLU seems essential for ovarian cancer cells to resist TX.

Similar results have been obtained in cervical cancer [40]. Thus, up-regulation of s-CLU might be a candidate marker to predict ovarian cancer chemo-resistance, while its reduction after drug administration may predict chemo-response when tumor cells have high endogenous CLU. Importantly, our results support the idea that, s-CLU is a stress-associated cytoprotective protein that is up-regulated in an adaptive cell survival manner following various cell death trigger including chemotherapy in ovarian cancer cells as well as in most cancer cells [41, 35]. Therefore,

novel therapeutic strategy of silencing s-CLU expression to overcome chemoresistance were suggested when cancer cells over-express s-CLU as in lung [42], prostate [43], kidney [44] or breast [13]. In the current study, we firstly demonstrated that OGX-011, a second-generation antisense oligodeoxynuclotide targeting LB-100 in vivo the translation initiation site of human CLU gene exon II with a long tissue half-life, can modulate sensitivity

to TX in an acquired TX-resistant ovarian cancer cell line. OGX-011 improved the efficacy of chemotherapy, radiation, and hormone withdrawal by inhibiting expression of CLU and enhancing apoptotic rates in preclinical xenograft models of prostate, lung, renal cell, breast, and other cancers [44–46]. Interference with the innate apoptotic activity is a hallmark of neoplastic transformation and tumor formation. Modulation of the apoptotic cascade has been proposed as a new approach for the treatment of cancer. Phenoxodiol [47] and XIAP inhibitor [48] are currently tested in clinical trials as chemosensitizer for chemoresistant tumors [49]. recently reported the result of the phase II study of docetaxel and prednisone with or without OGX-011 in patients with metastatic castration-resistant prostate selleck chemical cancer. They have shown that combination of OGX-011 with docetaxel significantly improved survival [49]. We do hope to test the efficacy of OGX-011 as a chemosensitizer to standard cytotoxic drugs for the patients with recurrent (resistant tumor) and refractory ovarian cancer. Conclusions In summary, present study demonstrated that alterations of s-CLU biogenesis are induced during development of TX-resistance. These changes include overexpression inside cells and subsequent secretion into media positively correlates to chemo-resistant phenotype.

Appl Surf Sci 2013, 267:81–85.CrossRef 17. Fauquet C, Dehlinger M, Jandard F, Ferrero S, Pailharey D, Larcheri S, Graziola R, Purans J, Bjeoumikhov A, Erko A, Zizak I, Dahmani B, Tonneau D: Combining scanning probe microscopy

and X-ray spectroscopy. Nanoscale Res Lett 2011, 6:308.CrossRef 18. de Chateaubourg SP: La spectrométrie PF-02341066 supplier de fluorescence X et l’analyse quantitative de couches minces à l’aide d’échantillons massifs. 1995. [Application au dosage des aérosols atmosphériques] PhD Thesis, Université Paris VII-Paris Diderot PhD Thesis, Université Paris VII-Paris Diderot 19. Henke BL, Gullikson EM, Davis JC: X-ray interactions: photoabsorption, scattering, transmission and reflection at E = 50–30000 eV, Z = 1–92. Atom Data Nucl Data Tables 1993,54(2):181–342.CrossRef 20. Hemberg O, Otendal M, Hertz HM: Liquid-metal-jet

anode electron-impact X-ray source. Appl Phys Lett 2003,83(7):1483.CrossRef 21. Bjeoumikhov A, Bjeoumikhova S, Wedell R: Capillary optics in X-ray Analytics. Part Part Syst Char 2006, 22:384–390.CrossRef 22. Bjeoumikhov A, Langhoff N, Bjeoumikhova S, Wedell R: Capillary optics for micro x-ray fluorescence analysis. Rev Sci Instrum 2005, 76:063115–1-063115–7.CrossRef 23. Tonneau D, Fauquet C, Jandard F, Purans J, Bjeoumikhov A, Erko A: Device for selleck compound topographical characterisation and chemical mapping see more of surfaces. 2011. European Patent PCT/IB2011/052423 Competing however interests Patent concerning the detection of XRF through capillary optics is pending (European patent # PCT/IB2011/052423, 2011). The authors declare that they have no competing interests. Authors’

contributions MD and OA carried out the experiments. SL and FJ were involved in instrument design, fabrication and calibration. MD, VA and DT carried out the simulations. CF, AB and DT participated in data interpretation and discussion. DT coordinated this study. MD, CF and DT drafted the manuscript. All authors read and approved the final manuscript.”
“Background Quantum dot solar cells have attracted much attention because of their potential to increase conversion efficiency [1]. Specifically, the optical absorption edge of a semiconductor nanocrystal is often shifted due to quantum size effects. The optical band gap can then be tuned to an effective energy region for absorbing the maximum intensity of the solar radiation spectrum. Furthermore, quantum dots produce multiple electron–hole pairs per photon through impact ionization, whereas bulk semiconductor produces one electron–hole pair per photon. A wide-gap semiconductor sensitized by semiconductor nanocrystals is a candidate material for such use. Wide-gap materials such as TiO2 and ZnO can only absorb the ultraviolet (UV) part of the solar radiation spectrum. The semiconductor nanocrystal supports the absorption of visible (vis) and near-infrared (NIR) light.

In addition to the tellurite-resistance marker, pMo130-TelR https://www.selleckchem.com/products/mk-4827.html also carries a kanamycin-resistance marker, the reporter gene xylE which converts pyrocathechol to a yellow-colored 2-hydroxymuconic semialdehyde,

and a modified sacB gene [8]. Next, DNA fragments of approximately 1 kb upstream and 1 kb downstream of the target region to be deleted was ligated with linearized pMo130-TelR give pMo130-TelR-(Up/Down) (Figure  1A). Figure 1 Strategy for deleting adeL-INCB028050 adeFGH and adeIJK operons in MDR A. baumannii DB and R2. Panel A, The upstream (UP) and downstream (DOWN) regions (approximately 1 kb) flanking the target genes was cloned into the suicide vector, pMo130-TelR. pMo130-TelR was constructed by inserting a 3.26 kb XmaI-digested tellurite-resistance cassette from pwFRT-TelR into the XmaI site of pMo130. Recombinants obtained after first cross-over were selected for inheritance of tellurite-resistance and xylE + (yellow colonies). These recombinants also do not produce any amplimers with the primer pair pMo130Tel F and pMo130Tel R. During the second cross-over, mutants with gene deletion (1) were selected

SN-38 manufacturer for loss of sacB by passaging the first cross-over recombinants in media containing sucrose. The second cross-over could also yield parental genotype (2). Deletion of the adeFGH operon (Panel B) and the adeIJK operon (Panel C) showing the positions of the respective UP and DOWN fragments flanking each deletion (striped and hatched boxes, respectively). The locations of the PCR primers used for amplifying

the UP and DOWN fragments and for qRT-PCR analysis of gene expression are indicated by black arrows while P1, P2 and Nutlin-3 manufacturer P3 (grey arrows) are the locations of predicted promoters for adeFGH operon, adeL, and adeIJK operon, respectively. To construct the suicide plasmid for deletion of adeFGH, a 1 kb DNA fragment located upstream of adeF was amplified from R2 genomic DNA using the primer pair: AdeGUp(Not1)F and AdeGUp(BamHI)R (Figure  1B). The amplimer was digested using Not1 and BamHI and inserted into pMo130-TelR, creating pMo130-TelR-adeFGH(UP). Next, another 1 kb fragment located downstream of adeG was amplified using the primer pair: AdeGDwn(BamHI)F and AdeGDwn(Sph1)R and cut with BamHI and SphI, and inserted into pMo130-TelR-adeFGH(Up), thus creating pMo130-TelR-adeFGH(Up/Down) (Figure  1B). The plasmid construct was first introduced in E. coli S17-1 and subsequently delivered into A. baumannii R2 and DB by biparental conjugation. A. baumannii transconjugants (first crossovers) were selected on LB agar containing 30 mg/L tellurite and 25 mg/L gentamicin. These tellurite-resistant colonies which carry genomic insertion of pMo130-TelR-adeFGH (Up/Down) produced yellow colonies when sprayed with 0.

PubMedCrossRef 39. Shaw DM, Gaerthé B, Leer RJ, Van der Stap JG, Smittenaar C, Heijne Den Bak-Glashouwer M, Thole JR, Tielen FJ, Pouwels PH, Havenith CE: Engineering the microflora to vaccinate the mucosa: serum immunoglobulin G responses and activated draining cervical lymph nodes following mucosal application of tetanus toxin fragment C-expressing lactobacilli . Immunology 2000, 100:510–518.PubMedCrossRef 40. Xin KQ, Hoshino Y, Toda Y, Igimi S, Kojima Y, Jounai

N, Ohba K, Kushiro A, Kiwaki M, Hamajima K, Klinman D, Okuda K: Immunogenicity and protective efficacy of orally administered recombinant Lactococcus lactis expressing surface-bound HIV. Env Blood 2003, 102:223–228.CrossRef 41. Fagarasan S, Honjo T: Intestinal IgA synthesis: regulation of front-line body defences. Nat Rev Immunol 2003, 3:63–72.PubMedCrossRef 42. Sambrook J, Fritisch EF, Maniatis T: Molecular Cloning: A Laboratory Manual. 3 Edition New York: Cold Spring Harbor Laboratory #BIX 1294 price randurls[1|1|,|CHEM1|]# 2001. 43. Sambrook J, Fritisch EF, Maniatis T: Molecular cloning: a laboratory manual. 2 Edition Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY 1989. 44. Shifang J, Yinyu W, Xinhua G, Liandong H: The factors affected transformation efficiency of Lactobacillus by electroporation. selleck products Chin J Biotechnol 1998, 14:429–33. 45. Cortes-Perez NG, Luis G: Mice immunization with live lactococci displaying a surface anchored HPV-16 E7 oncoprotein. FEMS Microbiol Lett 2003, 229:37–42.PubMedCrossRef

46. McCluskie MJ, Davis HL: CpG DNA is a potent enhancer of systemic and mucosal immune responses against hepatitis B surface antigen with intranasal administration to mice. J Immunol 1998, 161:4463–4466.PubMed 47. Ho PS, Wang JK, Lee YK: Intragastric administration of Lactobacillus

casei expressing transmissible gastroentritis coronavirus spike glycoprotein induced specific antibody production. Vaccine 2005, 23:1335–42.PubMedCrossRef Authors’ contributions XQ carried out construction of expression plasmid, participated in the sequence alignment and drafted the manuscript. GL carried out the protein expression and immunoassays. XW and XL carried out the Immunizations. ML performed the statistical Oxaprozin analysis. YL conceived of the study, and participated in its design and coordination. All authors read and approved the final manuscript.”
“Background The Atlantic cod (Gadus morhua) is a cold-adapted fish species which has been captured for human consumption for many years. It is a perishable commodity and for that reason, preservation methods like freezing or salting have traditionally been used to extend its shelf life [1, 2]. The fish is a microbial ecosystem of its own where the ecological principles of succession are as valid as in any other ecosystem. This microbiological environment consists of a high nutrient content with an oxygen tension favourable to the proliferation of fast-growing heterotrophs also responsible for the spoilage of food [3–5].

Granular bodies of approximately 35 nm in diameter were observed in the spaces between the parallel lamellae of the main rod (Figure 5B). The ventral side

of the main rod was embedded in an amorphous matrix that became thinner toward the click here posterior end of the cell, until it disappeared altogether (Figure 6A-D). A single row of longitudinal microtubules lined the external side of the main rod, which delimited the boundary between the main rod and the accessory rod for most of their length (Figure 5A-B). Figure 5 Transmission electron micrographs (TEM) of non-consecutive serial sections of Bihospites bacati n. gen. et sp. through the vestibular Blasticidin S mw region of the cell. A. TEM showing the nucleus (N) with

condensed chromatin, the dorsal side of the C-shaped rod apparatus consisting of the main rod (r) and the accessory rod (ar), and the vestibulum (vt). Several rod-shaped bacteria (black arrows) and spherical-shaped bacteria line inner surface of the vestibulum (vt) (bar = 10 μm). B. High magnification view of the C-shaped rod apparatus in Figure A showing the single row of microtubules (arrowheads) positioned at the junction between the tightly connected rod and accessory rod. Granular bodies (arrows) are present between the parallel lamellae Tozasertib price that form the main rod (bar = 500 nm). C, D. Transverse TEMs showing the cytostomal funnel (cyt) and two separate lobes of the feeding pocket (arrowheads). Bacterial profiles can be seen inside the feeding pocket (arrows). Figure D uses color to distinguish between the feeding pocket (red), the vestibulum (blue), and the two branches of the flagellar pocket (green). E, F. Transverse TEMs at a more posterior level than in Figure C-D showing the posterior end of the main C-shaped rod (arrow) emerging within the posterior end of the feeding triclocarban pocket. The cytostomal funnel (arrowheads) opens and fuses with the feeding

pocket. Figure F uses color to distinguish between the feeding pocket (red), the vestibulum (blue), and the two branches of the flagellar pocket (green). (C-F bar = 2 μm). Figure 6 Transmission electron micrographs (TEM) of non-consecutive serial sections through the flagellar apparatus and feeding pockets of Bihospites bacati n. gen. et sp. TEMs taken at levels posterior to those shown in Figure 5 and presented from anterior (A) to posterior (D). A. TEM showing the posterior end of the main C-shaped rod (r) embedded in an amorphous matrix (double arrowhead) and surrounded by a thick membrane with fuzzy material (arrowhead). At this level, the rod is associated with ‘congregated globular structure’ (CGS), and the striated fibres that form the accessory rod (ar) appear near the cytostomal funnel (cyt) at the junction between the feeding pocket and the flagellar pocket.

[13, 24]. Results Characterization of mAb MEST-3 Aiming to study the biological role of GIPCs, and since expression of these glycoconjugates with terminal

galactofuranose residues, which are recognized by MEST-1, is restricted to P. brasiliensis (Pb), H. capsulatum (Hc) and A. fumigatus (Af), we decided to develop a mAb directed to GIPC Pb-2, from P. brasiliensis, which structure Manpα1→3Manpα1→2IPC is expressed in a wide variety of fungi, and therefore a mAb directed to such structure would be highly desirable to detect a large number of pathogenic fungi. Among a few clones showing reactivity with GIPC Pb-2, a clone secreting an IgG2a monoclonal antibody was established, and termed MEST-3. By HPTLC-immunostaining (Figure 1B, lanes 1-3) it was observed Evofosfamide mw that MEST-3 reacts with Pb-2 from

yeast and Ruxolitinib concentration mycelium forms of P. brasiliensis, and other GIPCs containing the same structure as Pb-2, such as Hc-Y2 from yeasts of H. capsulatum (Figure 1B, lane 7), Ss-Y2 from yeasts of S. schenckii (Figure 1B, lane 9), Af-2 from hyphae of A. fumigatus (Figure 1B, lane 4), and An-2 from hyphae of A. nidulans (Figure 1B, lane 5). Moreover, lanes 6 and 8 of Figure 1A-B confirm that mycelium forms of H. capsulatum and S. schenckii do not express GIPCs bearing the epitope recognized by MEST-3, as described before [8, 9, 22, 23]. Also, by solid-phase radioimmunoassay (RIA), it was verified that this website mAb MEST-3 was able to detect as low as 5 ng of purified Pb-2, Hc-Y2, SS-Y2 and Af-2 (Figure 1C). Conversely, no reactivity of MEST-3 with GIPCs, presenting

the structures Manp(α1→3) [Galf(β1→6)]Manp(α1→2)IPC (Pb-3, Hc-Y3, Af-3); Manα1→2IPC (MIPC) and Manα1→3Manα1→6IPC (Ss-M2), was detected by HPTLC-immunostaining or RIA. Figure 1 Reactivity these of fungal GIPCs with MEST-3. Fungal GIPCs were purified by a combination of chromatography in DEAE-Sephadex, silica gel 60, HPLC and preparative HPTLC. HPTLC was developed in solvent A. Panel A, stained with orcinol/H2SO4 and panel B, immunostaining with MEST-3. Lane 1, GIPC Pb-2 from mycelium form of P. brasiliensis; lane 2, acidic GSLs from mycelium form of P. brasiliensis; lane 3, acidic GSLs from yeast form of P. brasiliensis (Pb); lane 4, acidic GSLs from hyphae of A. fumigatus (Af); lane 5, acidic GSLs from hyphae of A. nidulans (An); lane 6, acidic GSLs from mycelium form of H. capsulatum (Hc); lane 7, acidic GSLs from yeast form of H. capsulatum; lane 8, acidic GSLs from mycelium form of S. schenckii (Sc); lane 9, acidic GSLs from yeast form of S. schenckii; lane 10, acidic GSLs from the edible mushroom Agaricus blazei (Ab). Arrows indicates chromatographic migration of Pb-2, Af-2, An-2, Hc-Y2 and Ss-Y2. Panel C, GIPCs (first well 0.