Methods Cell culture and infection The human osteosarcoma cell li

Methods Cell culture and infection The human selleck osteosarcoma cell line, SaOS2 and 293T cells were purchased from the American Type Culture Collection. Cells were grown in 5% CO2 saturated humidity, at 37°C and cultured in DMEM (Gibco, USA) supplemented with penicillin/streptomycin, 2 mmol/L glutamine and 10% FBS. Cells were subcultured at 9 × 104 cells per well into 6-well tissue culture plates. After 24 h culture, cells were infected with recombinant

lentivirus vectors at a multiplicity of infection (MOI) of 40. Design of shRNA and plasmid preparation We designed and cloned a shRNA template into a lentivirus vector previously used [5]. A third generation self-inactivating lentivirus vector pGCL-GFP learn more containing a CMV-driven GFP reporter and a U6 promoter upstream of the cloning sites. Three coding regions corresponding to targeting human COX-2 (GenBank Accession: NM 000963.2) were selected as siRNA target sequences (Table

1) under the guide of siRNA designing software offered by Genscript. We constructed three shRNA-COX-2 lentivirus vectors, namely LV-COX-2siRNA-1, LV-COX-2siRNA-2 and LV-COX-2siRNA-3, respectively. To detect the interference effects of different target, COX-2 mRNA and protein levels were determined using RT-PCR and western blotting. Recombinant lentivirus vectors and control lentivirus vector were produced by co-transfecting with the lentivirus expression plasmid and packaging plasmids

in 293T cells. Infectious lentiviruses NCT-501 were harvested 48 h post-transfection, centrifuged and filtered through 0.45 um cellulose acetate filters. The infectious titer was determined by hole-by-dilution titer assay. The virus titers produced were approximately 109 transducing u/ml medium. Table 1 Interfering sequence specified for COX-2 gene   Sequence LV-COX-2siRNA-1 Oligo1: 5′TaaACACAGTGCACTACATACTTAtcaagagTAAGTATGTAGTG CACTGTGTTTTTTTTTC3′   Oligo2: 5′TCGAGAAAAAAaaACACAGTGCACTACATACTTActcttgaTAA GTATGTAGTGCACTGTGTTTA3′ LV- COX-2siRNA-2 Oligo1: 5′TaaTCACATTTGATTGACAGTCCAtcaagagTGGACTGTCAATC AAATGTGA TTTTTTTTC3′   Oligo2: 5′TCGAGAAAAAAaaTCACATTTGATTGACAGTCCActcttgaTGG ACTGTCAATCAAATGTGATTA3′ PD184352 (CI-1040) LV- COX-2siRNA-3 Oligo1: 5′TaaCCTTCTCTAACCTCTCCTATTtcaagagAATAGGAGAGGTT AGAGAAGGTTTTTTTTC3′   Oligo2: 5′TCGAGAAAAAAaaCCTTCTCTAACCTCTCCTATTctcttgaAAT AGGAGAGGTTAGAGAAGGTTA3′ The three interfering sequence targeted for human COX-2 gene were named LV-COX-2siRNA-1, LV-COX-2siRNA-2 and LV-COX-2siRNA-3, whose coding regions were corresponding to directly at human COX-2 (NM 000963.2) starting at 352, 456 and 517, respectively. Cell proliferation assay Cell proliferation was determined by 3-(4,5-dimethylthiazole-2-yl)-2,5-diphenyltetrazolium bromide (MTT) assay.

Comments are closed.