Reverse-transcriptase PCR analysis Total RNA were isolated from cultured cells or tumor samples by using Trizol

(Invitrogen, USA) according to the manufacturer’s instruction. Complementary DNA (cDNA) was synthesized by reverse transcription of 1 μg RNA samples with SuperScript pre-amplification system (Promega, Madison, MI). One tenth of the reverse transcribed RNA was used in PCR reaction. The primer sequences were as follows: GAPDH forward 5′ – GAAGGTGAAGGTCGGAGTC-3′ and reverse 5′- GAAGATGGTGATGGGATTTC′ (product 300 bp); Ku80 forward 5′-ACGATTTGGTACAGATGGCACT−3′ and reverse 5′-GCTCCTTGAAGACGCACAGTTT −3′ (product 497 bp). RT-PCR products were separated by electrophoresis on 1.5% agarose AZD7762 concentration gel containing ethidium bromide. Western blot analysis Total protein was isolated from culture cells or tumor samples and subjected to western blotting analysis as previously described [20]. Equal amounts of protein (40 μg) as determined by the Protein Assay Kit (Bio-Rad, Hercules, CA) was separated by 12% PAGE and transferred onto nitrocellulose membranes (Millipore, Bedford, MA). The membranes were blocked with 5% Bioactive Compound Library molecular weight nonfat milk diluted in buffer (10 mM Tris–HCl, 100 mM NaCl and 0.1% Tween 20) for 1 h at room temperature. The membranes were then incubated with primary antibodies at 1: 1000 dilution for Ku80, cleaved-PARP, cleaved-Caspase 3, or β-actin (Abcam,

MA, USA), followed

by incubation with Horseradish peroxidase-conjugated secondary antibodies (Thermo, Waltham, USA) at 1: 2000 selleck chemicals llc dilution for 1 h at room temperature. The protein bands were detected by an enhanced chemiluminescene kit (Pierce, Rockford, USA). Protein levels were quantified by densitometry using Quantity One software (Bio-Rad). Statistical analysis The data were presented as mean ± standard deviation. All statistical analysis was performed using SPSS.17.0 software (SPSS, Chicago, IL, USA). The paired-samples Wilcoxon signed rank Methamphetamine test was used to compare the expression of Ku80 between tumor and adjacent normal tissues. A 2-fold difference between control and test was considered the cut-off point to define high or low expression. Comparisons between treatments were made using one-way ANOVA for multiple group comparisons and differences between treatments were examined with a Tukey test. The correlation between Ku80 expression and clinic pathologic features was examined using the Pearson’s Chi-squared test. Overall survival and progression-free survival were calculated using the Kaplan–Meier method and log-rank tests. A 2-tailed P value of less than 0.05 was defined as statistical significance. Results Ku80 is overexpressed in lung adenocarcinoma tissues First we examined mRNA and protein expression of Ku80 in 106 pairs of snap-frozen lung adenocarcinoma and adjacent nonmalignant lung tissues.

GMPs include provisions for the facilities and equipment used to manufacture drugs, the education and training of personnel, and the Napabucasin nmr calibration and cleaning of process equipment. Validated analytical test procedures are used to ensure that drugs

conform to FDA-approved specifications for potency, purity, and other requirements such as sterility. All incoming ingredients and components must be retested upon receipt, and manufacturing processes must be validated to consistently meet quality standards. GMPs also require an independent quality control unit to oversee the manufacturing, packaging, and testing processes and to reject substandard batches. Stability studies must be performed to support expiration dating of products. 3 Pharmacy Compounding 3.1 Traditional Pharmacy Compounding The FDA defines traditional pharmacy compounding as the Epigenetics inhibitor combining, mixing, or altering of ingredients to create a customized medication for an individual patient in response to a licensed practitioner’s prescription [1]. The National Association of Boards of Pharmacy (NABP) further describes compounding as the result of a practitioner’s prescription drug order based on the practitioner/patient/pharmacist relationship in the course of professional

practice [7]. Traditional pharmacy compounding plays a valuable role in providing access to medications for individuals with unique medical needs, which cannot be met with a commercially available product. For instance, a prescriber may request that a pharmacist compound SPTLC1 a suspension for a pediatric or geriatric patient unable to swallow a medication in its commercially available form. In traditional pharmacy compounding, an individualized medicine is prepared at the request of a prescriber on a small scale. 3.2 Non-Traditional Pharmacy Compounding Some pharmacies have seized upon a burgeoning business opportunity to expand their activities beyond the scope of traditional pharmacy compounding [8]. Examples of improper

pharmacy compounding include introducing drug moieties that have not been approved for use in the US or have been removed by the FDA for safety reasons, large-scale production of compounded medications without prescriptions, and creating copies (or essentially copies) of FDA-approved drugs. The FDA issued PF-3084014 cell line letters in 2004 to compounding pharmacies obtaining domperidone from foreign sources for women to assist with lactation, noting that domperidone is not approved in the US for any indication. Citing public health risks, including cardiac arrest and sudden death, the FDA recommended that breastfeeding women avoid the use of domperidone [9]. The FDA has publically expressed concerns regarding “large-scale drug manufacturing under the guise of pharmacy compounding” [1, 2].

Furthermore, in some of the experiments the promoter activity was almost abolished for construct B, while other experiments showed only a low activity. The part of the promoter retained in construct A but lost in construct

B contains no known putative binding sites for transcriptional regulators. It should be noted that the differences of expression between the longer promoter fragments (Rigosertib mw constructs A-D) were significant within experiments (three independent measurements) but not always between the experiments. However, all experiments showed the same general expression pattern for fragments A-D even though the actual levels differed. The difference between the longer promoter fragments (construct Selinexor solubility dmso A-D) and the shortest fragment (construct E) were significant between all experiments. As expected, the positive control pPrbcL-gfp showed very high expression levels in all experiments (data not shown). Figure 4 Expression from the hupSL promoter deletions. Measurements of GFP fluorescence intensity

in living cells grown under nitrogen fixing conditions. Nostoc punctiforme ATCC 29133 cells were transformed with vector constructs containing truncated versions of the hupSL-promoter (A-E) fused to the reporter gene gfp (see Figs. 1 and 2). All values are normalised to the expression from the promoter less reporter vector, pSUN202 (negative control) and the GFP intensity is shown as relative intensity compared to the negative control. All measurements Histone demethylase were performed in triplicates. In situ localization of hupSL transcript To investigate Selleck Entospletinib if the truncated parts of the hupSL promoter, except from being important for the expression levels, also affected the cellular localization of hupSL transcription fluorescence

microscopy was used to view the living cells. Furthermore, this study was carried out to analyze if the high transcription level of the shortest promoter fragment (construct E, promoter fragment stretching from -57 to tsp) was the result of a general low expression in all cells rather than high specific expression in the heterocyst. Images of the filaments were taken using bright field and fluorescence microscopy and then merging the images. The micrographs showed that promoter fragments A-D had heterocyst specific expression (Fig. 5). Surprisingly, even the shortest promoter construct E showed a heterocyst specific expression (Fig. 5). The promoter region of PrbcL fused to gfp, used as a positive control, gave, as expected, high expression primarily in vegetative cells [49, 50] (Fig. 5). Figure 5 In situ localization of hupSL transcript. Micrographs showing localization of the GFP expression from the hupSL promoter in nitrogen fixing filaments of Nostoc punctiforme ATCC 29133. N. punctiforme cells were transformed with a self replicative vector, pSUN202, containing deletions of the hupSL promoter fused to gfp (see Fig. 1).

Exceptions are noteworthy, not only because they suggest tools for the discrimination of the fungus but also because they provide information valuable to our understanding of fungal evolution [46–48]. In that respect, intron Bbrrnl1 inserted within domain II of rnl’s secondary click here structure was located in a novel (unique) site amongst the 36 Ascomycota complete mt genomes examined (Additional

File 6, Table S6). Even though introns have been found in the same domain in Basidiomycota, for example Agrocybe aegerita [49], the uniqueness of this insertion site is of great importance to ascomycetes, as it may be a result of horizontal intron transfer. The fact that this intron encodes for a GIY-YIG homing endonuclease which shares homology with ORFs MEK inhibitor review in introns located in different genes in other fungal genomes further strengthens the hypothesis of horizontal transfer. Yet, such a hypothesis p38 MAP Kinase pathway remains to be experimentally tested. Recently, a thorough attempt was made to determine associations of morphological characteristics with molecular data in Beauveria species [1]. Based on ITS1-5.8S-ITS2 and EF-1a sequences 86 exemplar isolates were examined and assigned to six major

clades (A-F), where all known Beauveria species were included. B. bassiana isolates were grouped into two unrelated and morphologically indistinguishable clades (Clades A and C), while B. brongniartii formed a third sister clade to the other two (designated as Clade B). A new species, B. malawiensis, was later introduced and placed as sister clade to clade E [50], and several

other B. bassiana isolates pathogenic to the coffee berry borer from Africa and the Neotropics were added to Clades A and C [22]. Our results from the ITS1-5.8S-ITS2 dataset are in full selleckchem agreement with the grouping into Clades A-C and this division of B. bassiana isolates into two distinct clades is further supported by the mt intergenic region and the concatenated datasets with the best so far known bootstrap values. Mt genomes present different evolutionary rates compared to the nuclear [51] and topologies provided by one evolutionary pathway may not always indicate the correct relationships. As indicated by our findings, combining information from two independent heritages (nuclear and mt) may offer the possibility to resolve phylogenetic ambiguities. Thus, the two unrelated and morphologically indistinguishable B. bassiana clades proposed by Rehner and Buckley [1], i.e., the “”B. bassiana s.l.”", which contains the authentic B. bassiana (Clade A), and the “”pseudobassiana”" clade, which remains to be described (Clade C), are fully supported by our combined mt and nuclear data. Equally well supported by bootstrap is the placement of B. brongniartii strains as a sister clade to B. bassiana. The consistent clustering of the three B. bassiana isolates (our Clade A2 in Fig. 5 and Additional File 5, Table S5), which grouped basally to other B.

J Phycol 7:133–145 Hayes JM (1983) Geochemical evidence bearing on the origin of aerobiosis, a speculative

hypothesis. In: Schopf JW (ed) Earth’s earliest biosphere. Princeton University Press, Princeton, pp 291–301 Hayes JM, DesMarais DJ, Lambert IA, Strauss H, Summons RE (1992) Proterozoic biogeochemistry. In: Schopf JW, Kelin C (eds) The Proterozoic biosphere. Cambridge University Press, New York, pp 81–134 Hoering TC (1967) The organic geochemistry of Precambrian rocks. In: Abelson PH (ed) Researches in geochemistry, vol 2. Wiley, New York, pp 87–111 Hofmann HJ (2000) Archean stromatolites as microbial archives. In: Riding RE, Awramik SM (eds) Microbial sediments. Springer, Berlin, pp 315–327 Hofmann HJ, Grey K, Hickman AH, Thorpe RI (1999) Origin of 3.45 Ga coniform stromatolites in Warrawoona Group, Western Australia. Geol 4SC-202 research buy Soc Am Bull 111:1256–1262CrossRef Holland HD (2002) Volcanic gases, black smokers, and the great oxidation event.

Geochim Cosmochim Acta 66:3811–3826CrossRef House CH, Schopf JW, McKeegan KD, Coath CD, Harrison TM, Stetter KO (2000) Carbon isotopic composition of individual Precambrian microfossils. Geology 28:707–710CrossRefPubMed House CH, Schopf JW, Stetter KO (2003) Carbon isotopic signatures of biochemistry: fractionation by archaeans and other thermophilic prokaryotes. Organ Geochem 34:345–356CrossRef Igisu M, Ueno Y, Shimojima M, Nakashima Fosbretabulin cell line S, Awramik SM, Ohta H, Maruyama S (2009) Micro-FTIR spectroscopic signatures of Bacterial lipids in Proterozoic microfossils. Bacterial neuraminidase Precam Res 173:19–26CrossRef McKeegan KD, Kudryavtsev AB, Schopf JW (2007) Raman and ion microscopic imagery of graphitic inclusions in apatite from the >3830 Ma Akilia supracrustals, West Greenland. Geology

35:383–397CrossRef Mendelson CV, Schopf JW (1992) Proterozoic and selected Early Cambrian microfossils and microfossil-like www.selleckchem.com/products/Adrucil(Fluorouracil).html objects. In: Schopf JW, Klein C (eds) The Proterozoic biosphere. Cambridge University Press, New York, pp 865–951 Mojzsis S, Arrenhius G, McKeegan KD, Nutman AP, Friend CRL (1996) Evidence for life on Earth before 3,800 million years ago. Nature 384:55–59CrossRefPubMed Oehler DZ, Robert F, Walter MR, Sugitani K, Allwood A, Meibom A, Mostefaoui S, Selo M, Thomen A, Gibson EK (2009) NanoSIMS: insights to biogenicity and syngeneity of Archaean carbonaceous structures. Precam Res 173:70–78CrossRef Oparin AI (1938) The origin of life. McMillian, New York Pankratz HS, Bowen CC (1963) Cytology of blue-green algae. I. The cells of Symploca muscorum. Am J Bot 50:387–399CrossRef Park R, Epstein S (1963) Carbon isotopic fractionation during photosynthesis. Geochim Cosmochim Acta 21:110–115CrossRef Porter SM, Knoll AH (2000) Testate amoebae in the Neoproterozoic Era: evidence from vase-shaped microfossils in the Chuar Group, Grand Canyon.

The rapid drying was facilitated by the convenient volatility of chloroform [40]. The phyto-E and phyto-L-nanomodified wound dressing specimens were sterilized by ultraviolet irradiation for 20 min. Figure 1 illustrates the wound dressing with phyto-nanofluid coating. Figure 1 Schematic representation of the microbial biofilm development on the uncoated and coated wound dressings. (a) wound dressing fiber; (b)

biofilm development on the surface of wound dressing fiber; (c) coated wound dressing fiber by the obtained phyto-nanofluid; (d) poorly developed microbial biofilm on the surface of the modified textile material. Bacterial adherence and biofilm assay Selleck Tariquidar by viable cell count method Overnight bacterial cultures of P. aeruginosa ATCC 27853 and S. aureus ATCC 25923 were diluted in fresh Luria broth

(LB) up to a turbidity of 0.5 McFarland (approximately 1 × 108 CFU/mL), and 2 mL of the obtained suspension were seeded in 6 multi-well plates containing the wound dressing specimens previously sterilized by UV irradiation. The plates were incubated for 24 h at 37°C. For the adherence assay, after the incubation time, the materials were gently washed with sterile phosphate buffered saline (PBS) in order to remove the non-adherent bacteria and placed in 2 mL centrifuge tubes Selleck AZD6738 containing 1 ml of sterile PBS. The samples were vigorously mixed by vortexing for 1 min and sonicated Hydroxychloroquine price for 10 s [41]. Serial dilutions obtained from each sample were inoculated on LB agar plates in triplicates, and viable cell counts (VCCs) were assessed after incubation for 24 h at 37°C. For the biofilm assay, the materials containing attached bacteria were washed with sterile PBS and incubated in fresh LB broth for 24 h, 48 h, and 72 h at 37°C. After each incubation period, the samples were gently washed with sterile PBS, mixed by vortexing, and sonicated. Serial dilutions were placed on LB plates in triplicate. After 24 h of incubation at 37°C, VCCs were assessed. The experiment was repeated with three separate

occasions. Statistics For the statistical interpretation, we have used GraphPadInStat (GraphPad Software, Inc., CA, USA) and Prism softwares (Prism Software Corporation, CA, USA). The results were analyzed and compared using one-way analysis of variance (ANOVA) and Bonferroni Multiple Comparisons Test. P values lower than 0.05 were considered significant. Results and discussion Textile industry is a small part of the selleck chemicals llc global research in the emerging areas of nanotechnology, the fibers and textiles industries being in fact the first to have successfully implemented these advances and demonstrated the applications of nanotechnology for consumer usage [42]. Nanotechnologies have been largely used for different biomedical applications.

We have previously described

an in vitro system that allows us to measure mutation and transformation frequencies in H. pylori wild type strains and isogenic gene knock-out mutants, as well as the length of the donor DNA fragments imported into the recipient chromosome after transformation [12]. In this system, natural transformation of different H. pylori wild type strains with DNA from heterologous H. pylori donors led to the incorporation of 1.3-3.8 kb fragments into the recipient chromosome, depending on the combination LY2835219 of donor and recipient strains. Imports resulting from recombination contained short interspersed sequences of the recipient (ISR) in ~10% of the cases [12, 13], leading to complex mosaic patterns. The glycosylase MutY, a member of the base excision repair (BER) machinery, is involved in at least one ISR-generating pathway in H. pylori, repairing mismatches after the Copanlisib heteroduplex formation between recipient and donor DNA [12]. However, the inactivation of mutY in H. pylori did not completely abrogate the formation of ISR, suggesting that additional mechanisms might contribute to ISR generation. In addition to BER, H. pylori also contains a second gap-filling DNA repair system, the nucleotide excision repair pathway (NER), whose role in H. pylori mutation and EPZ5676 concentration recombination is yet poorly understood. In Escherichia coli, the NER

system is responsible for the replacement of bulky DNA lesions such as covalently modified bases, noncovalent drug nucleotide complexes and abasic sites generated by oxidative metabolism or ionizing radiation [14, 15]. Initiation of NER starts with the recognition of DNA distortions by the UvrAB complex [16]. After recognition, UvrA dissociates and UvrC is recruited and acts as a single-stranded DNA endonuclease, cleaving at both sides of the lesion selleck screening library [17, 18]. Finally, the unwinding activity of the UvrD helicase, which preferentially catalyzes a 3’ to

5’ unwinding, removes the excised segment. DNA polymerase I fills in the gap while the remaining nick is closed by ligase [19, 20]. In H. pylori, orthologs of the four NER genes, uvrA-D, have been identified [21]; but until now, only few studies have addressed the functions of these genes. H. pylori UvrB was shown to be involved in the repair of acid-induced DNA damage [22], and UvrD limited homologous recombination and DNA damage-induced genomic rearrangements between DNA repeats [23]. Here we have used a genetic approach to analyze the roles of the H. pylori NER system components in regulating the mutation rate, and the frequency and import patterns of homologous recombination after natural transformation. Results Characterization of H. pylori NER mutants and their susceptibility to UV light-induced cell damage To investigate how the NER system contributes to genetic diversification in H. pylori, we individually inactivated the NER genes in H.

Interestingly, the most biased codon usage (at least two fold change in RSCU) SBE-��-CD molecular weight is associated with codons of four amino acids: Gly, Pro, Ser and Thr (Additional file 4). These amino acids are among the abundant residues in DENV proteins (each contributes to >4% of total amino acid residues; note that the percentage of representation of the 20 amino acids to DENV proteins ranges from 1 to 10). The number of sites that are preferred in DENV is relatively less in number than the sites that are associated with non-preferred codons, a pattern which is consistent irrespective of geographical origin. This

suggests that the balance between mutation and codon selection in dengue virus is probably maintained irrespective of geographical structuring within serotypes. Context patterns of nucleotides in coding sequences The LY411575 research buy nucleotide context patterns of codon sequences of DENV were investigated. The base frequencies of 1st, 2nd and 3rd positions of codons are shown in Figure  3. It shows that A and G frequencies are relatively higher than C and T in the 1st positions of codons, whereas frequencies of A and T are relatively more frequent than that of C and G in the 2nd positions of codons in all four serotypes. On the other hand, in the 3rd positions of codons, the frequency of A is higher than that of C, G or T. The 3rd position of codons, being the silent position, this result suggests that

A-ending codons are preferred in DENV genes. This pattern is highly consistent among the samples in each serotype (data not shown). The nucleotide context patterns (i.e., Epacadostat purchase given a nucleotide, how frequently it makes neighboring context with itself or the other three nucleotides) were also investigated in the

coding sequences of the samples. Figure  3 shows frequency of Dipeptidyl peptidase each of the 16 possible nucleotide contexts. It shows that AA and GA nucleotide contexts are relatively more frequent than any other contexts in the coding sequences of the DENV genome. The CG contexts are least abundant in DENV genes. This pattern of nucleotide context frequencies is very similar among the samples in each serotype (Pearson correlation coefficient is greater than 0.93). Figure 3 Distribution of nucleotide frequency in codons. Pie chart representation of mean frequencies of the four nucleotides at 1st, 2nd and 3rd positions of codons in dengue virus (left). The chart on the right shows nucleotide context pattern (based on mean dinucleotide frequencies) in the coding sequences of dengue virus. The number after each nucleotide and nucleotide pair represents its proportion compared to the total nucleotide counts for that codon position (left) or total counts of dinucleotides in the coding sequences (right). The nucleotide frequency as well as the dinucleotide frequency varies in highly correlated manner (Pearson correlation > 0.

When it comes to bile tolerance, Bsh is probably what first comes to mind, since it involves the direct hydrolysis of bile salts. Although the ecological significance of microbial Bsh activity is not yet fully understood, the suggestion was made that it may play a major detoxification role [27]. L. plantarum strains carry four bsh genes (bsh1 to bsh4). Bsh2, bsh3 and bsh4 are highly RG7420 chemical structure conserved among L. plantarum species, while bsh1 is not and seems to be the major determinant of the global Bsh activity of L. plantarum strains. Besides, a bsh1-mutant of L. plantarum WCFS1 displayed a decreased tolerance to glycine-conjugated bile salts [49]. In our study, a Bsh1 homologue could only be found

in the most resistant strain in standard this website conditions, XAV-939 datasheet but its amount decreased following the strain’s exposure to bile. This result contrasts with the bsh1 gene up-regulation in L. plantarum WCFS1 following bile challenge [45]. Strains from L. acidophilus and L. salivarius on the other hand did not seem to up-regulate their Bsh1 production following bile exposure

[38, 50]. Such discrepancy in regulation trends of bsh genes suggests that, depending on the considered strains and species, Bsh activity may or may not be a major determinant of bile resistance. Finally, it appeared that the six bile tolerance factors described above may contribute in various ways to the bile tolerance of L. plantarum strains. In particular, strains appeared to regulate key Thalidomide proteins differently following exposure to bile, which suggests that several strategies coexist in the bile adaptation process of L. plantarum species, some strains favoring certain specific pathways, while others downplaying them. Conclusions This work used comparative and functional proteomics to analyze cell-free protein extracts from three L. plantarum strains with different bile resistance properties. This approach showed that the natural protein diversity among L. plantarum strains cultured in standard conditions can reflect their ability to tolerate bile. The results provided an overview of proteomic patterns related to

bile tolerance, and showed a clear effect of bile salts on the level of expression of certain proteins within these patterns. Particularly, 13 out of the 15 proteins of interest were shown to be directly involved in the bile tolerance of L. plantarum, six of which could be part of specific bile adaptation pathways, including protection against oxidative stress (GshR1 and GshR4), maintenance of cell envelope integrity (Cfa2), and active removal of bile-related stress factors (Bsh1, OpuA, and AtpH). Also, analysis of changes in protein expression gave insight into the way the different strains use these pathways for their survival, suggesting complex, strain-specific and probably conflicting molecular mechanisms in the cell’s adaptation strategy to bile.

The protonated polymer at pH 3 allows water to soak into the porous layer, giving rise to a shift in the photonic resonance. Conclusions We have developed an optical pH sensor based on a photonic pSi film where a pH-responsive polymeric layer on top of the porous layer modulates ingress of water into the layer. The pH-responsive polymer pDEAEA was chosen, synthesized

by RAFT polymerization, and spin-coated on pSi rugate filters. FTIR spectroscopy, interferometry reflectance spectroscopy, and water contact angle measurements were used to confirm the exclusive presence of the polymer at the external surface of the rugate filter. After exposing the pSi-pDEAEA to water droplets of different pH, the role of the polymer as a barrier was demonstrated in contrast to a control sample lacking the polymer. Penetration of water into the porous layer, associated to a change of color of the sample, only occurred at low pH. Our study therefore learn more provides proof-of-principle that photonic pSi can be used to detect pH changes in aqueous medium. This sensor can potentially be incorporated into wound dressings and used to report on acidification of chronic wound fluid as a result of bacterial infection through a color change that is visible to the unaided eye. Such a device would provide fast wound diagnostics to practitioners and nurses. Authors’ eFT508 information SPa is research associate at the Mawson Institute from the University of South

buy GS-1101 Australia. RV is a PhD student at the Mawson Institute from the University of South Australia. WZ is a PhD student at the Key Centre for Polymer Colloids in the School of Chemistry from University of Sydney. SPe is a full professor in the Department of Chemistry from the University of Warwick in UK. NV is a full professor from the Mawson Institute from the University of South Australia. Acknowledgements The authors would

like to thank the Wound Management Innovation CRC (Australia) for providing funding for this work. The authors thank the Australian Nanotechnology Network for providing a travel fellowship. Electronic supplementary material Additional file 1: Porous silicon photonic films. Porous silicon photonic films modified with the pH-responsive polymer poly(2-diethylaminoethyl acrylate) are employed to detect a change in pH, through a color change visible by the unaided eye. (DOCX 203 KB) References 1. Dargaville TR, Farrugia PAK5 BL, Broadbent JA, Pace S, Upton Z, Voelcker NH: Sensors and imaging for wound healing: a review. Biosens Bioelectron 2012, 41:30–42.CrossRef 2. Schneider LA, Korber A, Grabbe S, Dissemond J: Influence of pH on wound-healing: a new perspective for wound-therapy? Arch Dermatol Res 2007, 298:413–420.CrossRef 3. Shi L, Ramsay S, Ermis R, Carson D: pH in the Bacteria-contaminated wound and its impact on clostridium histolyticum collagenase activity: implications for the use of collagenase wound debridement agents. J Wound Ostomy Continence Nurs 2011, 38:514–521. 510.1097/WON.