coli Sm10 into V. anguillarum by conjugation. Transconjugants were selected by utilizing the chloramphenicol resistance gene located on the suicide plasmid. The incorporation of the recombinant pNQ705 was confirmed by PCR amplification. Table 3 Primers used in this study Primers Sequence (5′ to 3′, italicized sequences are designed restriction sites) Purpose and description Reference Pm262 ATCGAGGATCCATGAAACTAATGACGTTATTG For whole Plp protein, forward This study Pm263 ATCGAAGATC Bortezomib TTTGAAATTGAAATGACGCGAG https://www.selleckchem.com/products/ca-4948.html For whole Plp protein, reverse This study Pm212 GACACCTCACAATATGAAATAAAA For truncated Plp protein, forward This study Pm213 TTTGAGCTGCGGGGCTTTGGTTGC
For truncated Plp protein, reverse This study Pm261 ATCGAGAGCTCGCAGAATCGTGACTGACGCCG For insertional plp mutation, forward, with SacI site This study SD Lip/Heme R1 GCTAGTCTAGAACGGATACCACCTCAGA For insertional plp mutation, reverse, with XbaI site [8] pr1 GGGGAATTCTTATTCAAATTGAAATGACGCGAG For plp complement, forward, with EcoRI site This study pr2 GGGACCGGTGAATACCCATTTTTTATTTTTTC For plp complement, reverse, with AgeI site This study pr3 GTTGAATTCGTATTTTCTGCAATCGCCATG For vah1 complement, forward, with EcoRI site This study pr4 GGGACCGGTCTATTTTATAATAAATTGAATACCAT
For vah1 complement, reverse, with AgeI site This study Pm256 ATCGACTCGAGCTGGAGAAGATGTACTCTGCG For allelic exchange rtxA mutation, flanking the 5′ region, forward, I-BET-762 purchase with XhoI site This study Pm257 ATCGATCTAGACGTATCATCTACAGCTTTTGC For allelic exchange rtxA mutation, flanking the 5′ region, reverse, with XbaI site This study Pm258 ATCGATCTAGATTATATTAATCATGTCTTTTATGGG For allelic exchange rtxA mutation, flanking the 3′ region, forward, with XbaI site This study Pm259 ATCGAGAGCTCCTGATTGCCTAGCAGTAGCCC For allelic exchange rtxA mutation, flanking the 3′ region,
reverse, with SacI site This study pr7 CAGGAAACAGCTATGACCATGATTACG For sequencing of the DNA fragment inserted in pCR2.1 TA-ligation site This study pr8 CTACGGGCTTGAGCGTGACAATC For sequencing of the DNA fragment inserted in pSUP202 AgeI site This study pr25ex GCTGTCCCTCCTGTTCAGCTACTGACGGGGTGGTGCG For sequencing of the DNA fragment inserted in pNQ705-1 Multi-cloning site This study Allelic exchange mutagenesis The allelic exchange rtxA mutation in V. anguillarum S264 was made by using a modification of the procedure Uroporphyrinogen III synthase described by Milton et al.[28]. The 5′ region of rtxA was amplified using the primer pair pm256 and pm257 (Table 3), digested with XhoI and XbaI, and then cloned into the region between the XhoI and XbaI sites on pDM4 (GenBank accession no. KC795686), deriving pDM4-rtxA5′. The 3′ region of rtxA was amplified using the primer pair pm258 and pm259 (Table 3), digested with XbaI and SacI, and then cloned into the region between the XbaI and SacI sites on the pDM4-rtxA5′. The resulting pDM4-rtxA5′-rtxA3′ was transformed into E. coli Sm10 to produce the transformant strain S252, which was mated with V. anguillarum S171 (vah1).