A volume of 10 μl of MTT was added to each well, followed by mixing. Plates were incubated for 3 hours at 37°C in a humidified atmosphere of 5% CO2 and 95% air. Formazan levels, which correspond to the number of viable cells, were

quantified using a microplate reader (model 450; Bio-Rad Laboratories, BLZ945 ic50 Hercules, CA, USA) at a wavelength of 450 nm. The absorbance of each well was evaluated at 6, 12, 24, 48, 72, 96 and 120 hours after seeding. Triplicate wells were used for each observation. Immunohistochemistry Cells were cultured in chamber slides (Lab-Tek; Nalge Nunc International, Naperville, IL, USA). For the detection of mesenchymal phenotype, we used 3 monoclonal antibodies: anti-AE1/AE3, anti-keratin mix, and anti-vimentin. Also, to assess osteoblastic differentiation, we used 2 monoclonal antibodies: anti-OP and anti-OC. ALP activity of UTOS-1 cells was estimated using a modified version of a cytochemical method described elsewhere [13], with naphthol AS-MX phosphate-fast blue RR staining (ALP staining kit; Muto Pure Chemicals Cell Cycle inhibitor Corporation, Tokyo, Japan). Cells grown in chamber slides were washed in PBS, fixed in 4% paraformaldehyde for 15 minutes at room temperature, and then fixed in methanol for 20 minutes at -20°C. The cells were incubated with each of the primary antibodies for 24 hours at 4°C. Immunoreaction products were detected using DAKO

envision (DAKO Sytomation, Carpinteria, Edoxaban CA, USA), and were visualized after adding diaminobenzidine (DAB; DAKO) as the chromogen. RNA extraction and reverse-transcription polymerase chain reaction (RT-PCR) Expression of osteoblastic differentiation markers was assessed using RT-PCR. UTOS-1 cells were grown to confluence, and total cellular RNA was isolated using a TRIzol® Reagent (Invitrogen, San Diego, CA, USA). Total RNA was used as a template for cDNA selleck synthesis using the SuperScript First-strand Synthesis System (Invitrogen). PCR was performed

to assess expression of ALP, OP and OC. The oligonucleotide primer sequences and PCR conditions for ALP, OP and OC are shown in Table 1. Amplified products were analyzed by 2% agarose gel (Cambrex Bio Science Rockland Incorporation, Rockland, ME, USA) electrophoresis and ethidium bromide staining (Invitrogen). For comparison, Saos-2 [7], which is one of the most popular OS cell lines, was used as a positive control. Table 1 The oligonucleotide primer sequences and PCR conditions for ALP, OP, and OC in this study. Molecule Primers (5′ to 3′) Strand Size (bp) Conditions (temperature, cycle number) ALP ACGTGGCTAAGAATGTCATC CTGGTAGGCGATGTCCTTA + — 475 55°C 35 cycles OP CCAAGTAAGTCCAACGAAAG GGTGATGTCCTCGTCTGTA + — 347 58°C 45 cycles OC ATGAGAGCCCTCACACTCCTC GCCGTAGAAGCGCCGATAGGC + — 294 59°C 45 cycles GAPDH GAAGGTGAAGGTCGGAGTCA GAAGATGGTGATGGGATTTC + — 226 55°C 35 cycle Abbreviations: ALP, alkaline phosphatase; OP, osteopontin; OC, osteocalcin; GAPDH, glyceraldehyde-3-phosphate dehydrogenase.