Tian L, Ghosh D, Chen W, Pradhan S, Chang X, Chen S: Nanosized carbon particles from natural gas soot. Chem

Mater 2009, 21:2803–2809. 10.1021/cm900709wCrossRef 35. Zhao Q-L, Zhang Z-L, Huang B-H, Peng J, Zhang M, Pang D-W: Facile preparation of low cytotoxicity fluorescent carbon nanocrystals by electrooxidation of graphite. Chem Commun 2008, 5116–5118. 36. Xing JZ, Zhu L, Jackson JA, Gabos S, Sun X-J, Wang X-b, Xu X: Dynamic monitoring Selleckchem AZD5363 of cytotoxicity on microelectronic sensors. Chem Res Toxicol 2005, 18:154–161. 10.1021/tx049721sCrossRef 37. Xing JZ, Zhu L, Gabos S, Xie L: Microelectronic cell sensor assay for detection of cytotoxicity and prediction of acute toxicity. Toxicol Vitro 2006, 20:995–1004. 10.1016/j.tiv.2005.12.008CrossRef AZD6244 38. Tao H, Yang K, Ma Z, Wan J, Zhang Y, Kang Z, Liu Z: In vivo NIR fluorescence imaging, biodistribution, and toxicology of photoluminescent carbon dots produced from carbon nanotubes and graphite. Small 2012, 8:281–290. 10.1002/smll.201101706CrossRef Competing interests The authors declare that they have no competing interests. Authors’ contributions LH carried out the preparation and characterization of RNase A@C-dots and drafted the manuscript. WQ finished

the MTT test. ZC finished the gastric cancer-bearing animal model preparation. LC and JW finished the RNase A@C-dots intratumor injection and imaging experiment. SG, WC, and CD designed and coordinated all the experiments. All authors read and approved the final manuscript.”
“Background The junctionless nanowire transistor (JNT), which contains a single doping selleck inhibitor species at the same level in its source, drain, and channel, has been recently investigated [1–6]. The junctionless (JL) device is basically a gated Tangeritin resistor, in which the advantages of junctionless devices include (1) avoidance of the use of an ultra shallow source/drain junction, which greatly simplifies the process flow; (2) low thermal budgets owing to implant activation anneal after gate stack formation is eliminated,

and (3) the current transport is in the bulk of the semiconductor, which reduces the impact of imperfect semiconductor/insulator interfaces. As is widely recognized, the temperature dependence of threshold voltage (V th) is a parameter when integrated circuits often operate at an elevated temperature owing to heat generation. This effect, accompanied with the degradation of subthreshold swing (SS) with temperature, causes the fatal logic errors, leakage current, and excessive power dissipation. Despite a previous work that characterized JNTs at high temperatures [7], there is no information regarding the JL thin-film transistor (TFT) at a high temperature yet. Hence, this letter presents a high-temperature operation of JL TFTs with a gate-all-around structure (GAA) for an ultra-thin channel. The JL TFT with a planar structure functions as the control device.

All authors read and approved the final manuscript.”
“Background Hepatocellular carcinoma (HCC) is the fifth most common malignant tumor worldwide, with over 600,000 new cases diagnosed each year, and selleck compound is the third most common tumor-related cause of death [1]. Hepatitis B virus (HBV) infection, hepatitis C virus infection, and aflatoxin-induced oncogene activation and tumor suppressor gene inactivation are the main

causes of HCC [2]. Surgical resection and liver transplantation may cure HCC, but about 85% of patients have locally advanced tumor or distant metastasis at the time of diagnosis, and are not suitable candidates for surgery [3]. Conventional chemotherapy for HCC has limited effectiveness, but recent breakthroughs in treatment with molecular-targeted drugs have been reported. Abnormalities of intracellular signaling pathways which result in abnormal cell proliferation and apoptosis are one of the main mechanisms of HCC development. click here Many complex cellular signaling pathways are

involved in tumor development and growth. These pathways include proteins such as vascular endothelial growth factor (VEGF), VEGF Selleck ON-01910 receptor (VEGFR), platelet-derived growth factor (PDGF), PDGF receptor (PDGFR), hepatocyte growth factor/c-Met, Ras/Raf/Mek/Erk, and PI3k/Ak/mTOR. High expression of VEGFR-2, PDGFR-β, and c-Met can be detected in many tumors, including HCC, but information regarding the relationships between expression of VEGFR-2, PDGFR-β, and c-Met and the clinicopathological factors and prognosis of HCC is very limited [4–7]. This study explored the relationships between expression of VEGFR-2, PDGFR-β, and c-Met and the clinicopathological factors and prognosis of HCC patients, aiming to provide reference information to assist with the diagnosis, evaluation of prognosis, and targeted therapy of HCC. Methods Specimens were collected from 93 HCC patients treated at the Department of Digestive Oncology, Chinese People’s Liberation Army 307 Hospital from January

2007 to October 2011. The specimens were collected from patients by biopsy and it was excluded Tolmetin if the biopsy specimen was too less. Sixty-five of these patients were taking sorafenib. All patients met the following inclusion criteria: (1) advanced stage HCC which was not suitable for surgery or local treatment, or had recurred after surgery or local treatment, (2) Child-Pugh class A or B, (3) Eastern Cooperative Oncology Group (ECOG) score 0 or 1, (4) at least one target lesion that had not been previously treated, (5) no local treatment for at least 4 weeks before baseline imaging, (6) availability of complete clinical and pathological data, including follow-up data. All specimens were fixed in 10% formaldehyde, embedded in paraffin, and cut into 4-μm thick slices before staining.

The increased expression of miR-19a in the plasma of bladder cancer patients suggested that miR-19a can be developed as a potential diagnostic marker click here which can be combined with other miRNAs’ expression to detect bladder cancer. Figure 5 Expression of miR-19a in the plasma of patients with bladder cancer. (A) Normalized expression of miR-19a in the plasma of 50 patients with bladder cancer and 50 healthy individuals. (B) Correlation of miR-19a expression in the plasma with the tumor grades of bladder cancer. Discussion The up-regulated

expression of miR-17–92 cluster has been reported in a variety of cancers including multiple myeloma, leukemia, colorectal cancer and breast cancer [22–24]. The miRNA cluster produces a single primary transcript yielding the six mature miRNAs: miR-17, miR-18a, miR-19a, miR-20a, miR-19b, and miR-92a. miR-19 has been identified selleck chemical as the key member responsible for the oncogenic activity [25,26]. However, the role of miR-19 in bladder cancer remains unknown. In this study, we investigated the expression of miR-19a in a great deal of patients with bladder cancer and dissected the roles and mechanisms of miR-19a in bladder cancer carcinogenesis. We found that miR-19a was significantly up-regulated in bladder cancer tissues and the high

expression of miR-19a was associated with the more aggressive phenotypes of bladder cancer. Gain or loss of function of miR-19a in bladder cancer cells also indicated that miR-19a can promote cell growth which Buspirone HCl was consistent with its role in other cancer types. The important role of miR-19a in regulating bladder cancer cell invasion, migration and in vivo carcinogenesis needs to be further confirmed. In case anti-miRs of miR-19a can suppress tumor growth in vivo significantly, miR-19a can be further developed as new target for bladder cancer therapy as

miRNAs has selleckchem advantages of being small and easy to delivery, safer than other gene therapy methods [27,28]. To further dissect the mechanism by which miR-19a functioned as an oncogenic miRNA in bladder cancer, we analyzed the relationship of miR-19a and PTEN in bladder cancer and found that the regulatory role of miR-19a in bladder cancer cells was dependent on targeting PTEN. PTEN is identified as a tumor suppressor that is mutated in a large number of cancers at high frequency. It negatively regulates intracellular levels of phosphatidylinositol-3,4,5-trisphosphate in cells and functions as a tumor suppressor by negatively regulating AKT/PKB signaling pathway [29–31]. AKT/PKB signaling pathways answer to growth factors and other extracellular stimuli to regulate several cellular functions including nutrient metabolism, cell growth, apoptosis and survival. miR-19a may repress the expression of PTEN which further lead to the unlimited cell proliferation of bladder cancer cells.

Thus, the second

and third terms are cancelled and the HETP of an MCC is equal to its single capillary; the sample capacity is simply multiplied by the number of capillaries in the bundle [15]. Therefore, Equation 2 can be used to express the HETP of the MCC. Figure 5 shows calculated HETPs versus average Torin 2 concentration carrier gas velocity from Equation 2. D g and D s values are chosen as 0.093 cm2/s and 6.4 × 10−6 cm2/s, respectively, and the k value is Etomoxir purchase 3. The width, w, and height, h, of the channel are 60 and 450 μm, respectively. With increasing average carrier gas velocity, the curve drops dramatically and subsequently flattens (Figure 3). This finding indicates that at higher velocities, the column efficiency is not affected significantly with any further increase in the average flowrate of carrier gas. In practical applications, MCCs exhibit stability with variable velocity. With the average carrier gas velocity of 24 cm/s, the HETP of the column is only 0.0151 cm. The column achieves maximum column efficiency at this point. Figure 5 Height equivalent to theoretical plate ( H ) versus average carrier gas velocity

for the four-capillary micro MCC. Length = 50 cm, depth = 450 μm, and width = 60 μm. Experimental determination of column efficiency In our study, the internal unions and fused silica tubing serve as connectors to mount the Batimastat cost MCC on an Agilent GC 6890 system. Heliumis used as a carrier gas. A1:1 (v/v) mixture of DMMP and methyl salicylate is used as a sample. The inlet temperature is set to 250°C, and the sample volume is 0.1 μL with a split ratio of 200:1. The carrier gas velocity is set to

20 cm/s. The initial column temperature is set at 80°C and programmed to increase at rate of 30°C/min till it reaches 200°C. The observed retention times of DMMP and methyl salicylate are 0.766 and 1.682 min, respectively (Figure 6). The theoretical number of plates can be calculated based on the retention times (t R) of the peaks [15]. Figure 6 Separation of two component mixtures: DMMP and methyl salicylate. Column temperature = 130°C. (4) where is the width of the peak at half height. The number of plates for methyl salicylate Aspartate is 6,410 plates. With a 1-m length, the theoretical number of plates is 12,810 plates/m. The main advantage of short-length GC columns is its ability to separate components in a short period of time. Using Equation 4, the shorter retention time of peak, the lower plate number is worked out. Meanwhile, the resolution also deceases when components are eluted quickly from the column. In our design, we optimise MEMS-based MCC separation conditions by striking a balance between the time required for separation, and a rational resolution and plate number. Chromatographic separation of mixture components Here, because of restrictions associated with the use of CWAs, stimulants are used to test the separation efficiency of the MCC.

From our review, we found that compared to “usual care,” a pharmacist intervention that included patient counseling, education, QUS, and physician check details contact increased central DXA testing and calcium intake among individuals at high risk for osteoporosis. Although not specifically identified within the studies included in our review, a recent RCT identified that DXA testing among women aged 45–54 years significantly increased the use of osteoporosis pharmacotherapy and supplementation with calcium

and vitamin D [42]. Further research is needed to determine if pharmacy interventions may also improve osteoporosis treatment initiation. Result from studies included in our review support the use of heel QUS measurement as a feasible BMD screening method that can be utilized ICG-001 by pharmacists [36]. Although QUS is no Tipifarnib better than questionnaires based on simple risk factors, such as age, body weight, and sex in predicting those likely to have low BMD [43], offering a clinical service

such as BMD measurement may be important for the success of pharmacy-led osteoporosis interventions. In fact, one of the trials included in our review that compared patient satisfaction between two different pharmacist interventions found that peripheral BMD testing was important for patient recruitment and satisfaction [34]. Further research is needed to clarify the importance of BMD measurement on the success of community-based osteoporosis interventions. Our study has many strengths, including a thorough systematic search of the literature, having two independent reviewers search for an abstract

data and having a third author to resolve discrepancies. below We also focused on RCT study designs. Nonetheless, our results are limited to the quality and generalizability of the RCT studies identified. In fact, due to high risk of bias in two of the RCTs under review, non-experimental studies may have yielded similar quality results. If no plan exists to disseminate interventions outside a local setting, lower-quality evidence may be acceptable in quality improvement [44]. Evidence from non-experimental studies may thus be informative for local quality improvement interventions. Our study is also limited by qualitative assessment of risk of bias, which we ascribed as low or high risk based on our assessment of whether or not evidence existed to suggest that results may be biased. We had originally considered two quality assessment tools [45, 46] used in prior reviews of pharmacist interventions [8, 39–41]. However, upon the application of these quality assessment tools, we found that neither differentiated between the studies well.

The inference of a close genetic relationship between APEC and human ExPEC strains was further EGFR inhibitors cancer substantiated by the distribution of tkt1. About 67% of UPEC and 76.4% of NMEC strains examined in this study harbor tkt1. Like many other virulence genes of ExPEC, tkt1 is also phylogenetically distributed. Of the ExPEC belonging to B2 phylogenetic group, 85.2% APEC, 94.0% of UPEC and 98.6% of NMEC were positive for tkt1. E. coli from phylogenetic group B2 have already

been experimentally and GSK2126458 epidemiologically associated with extraintestinal infections [29, 30]. These results also suggest that tkt1 may play a role in the pathogenesis of human ExPEC as well as APEC. Genomic sequencing of APEC O1 revealed more than 40 genomic islands; several of them are theoretically involved in virulence [9]. Common features of most, if not all PAIs, include that they encode one or more virulence factors; range

in size from 10 to 200 kb; and are likely introduced into the genome via horizontal transfer, resulting in G-C ratios and codon usage that may deviate from the organism’s typical pattern. Often PAIs are flanked by small direct repeats and are associated with the 3′ end of tRNA genes. PAIS may be phage-derived, but some are thought to originate from plasmids. They may contain mobility elements, such as integrons, transposons, and insertion INK 128 chemical structure sequences, and if they move, are likely carried on plasmids, conjugative transposons, or phages, whose loss may spontaneously convert a virulent into an avirulent organism [6]. Similarly, the genomic island encoding tkt1 is 16 Kb in size and present in the APEC O1 genome but absent from the sequenced genome of the E. coli K12 strain MG1655. Moreover, the overall G+C content of this island is 48.57%, whereas the average G+C content of the E. coli K-12 genome is 50.8%. This discrepancy in G+C content further suggests that this particular

stretch of DNA does not belong to the E. coli K12 backbone and is foreign-derived. Also, the genomic island encoding tkt1 is localized in close proximity to tRNA genes. Unlike classical PAIs, no flanking direct repeats or mobility elements such as integrases or transposases were found in this genomic island. However, such mobility elements may have been lost during the evolutionary process. Horizontal transfer of genes from by genomic islands or PAIs is a common phenomenon in extracellular bacterial pathogens. The acquisition of genes in this way allows bacteria to adapt to a new or changing environment thus contributing to the fitness and/or virulence of the recipient organism. Table 2 ORFs present within the tkt1 genomic island ORF No. ORF name Location of ORF Function G+C content APECO1_2646   4312693..4312950 hypothetical protein NC_008563 APECO1_2645   4312947..4313438 hypothetical protein NC_008563 APECO1_2644   4313787..4314080 hypothetical protein NC_008563 APECO1_2643   4314532..4315122 putative sugar isomerase NC_008563 APECO1_2642   4315164..

Multiple rectal biopsies were taken, and these showed the presence of ganglion cells and the absence of thickened nerves. This combination of histopathological findings did not support a diagnosis of Hirschsprung’s disease. Figure 6 Water Soluble Contrast Enema – Contrast was introduced per rectum. This was seen to flow

Selleck ON-01910 freely to the right side of the abdomen within the bowel. No extravasation of contrast or stricture was demonstrated. We conclude that neither the histopathology from the gross specimen nor the rectal biopsies is in keeping with a dysmotility disorder and hence this cannot explain the delayed recovery and prolonged ileus. Discussion There are only fifteen cases of paediatric transverse colonic volvulus so far in the literature including this present case (Table 1). Of all cases there was seven male and seven female children. Mocetinostat clinical trial One case had no sex documented. The mean age was ten years. Presenting

symptoms included abdominal distension: fifteen, vomiting: eleven, constipation: seven. The following past medical history were indicated in the patients; mental retardation: five, chronic constipation: five, previous Hirschprung’s disease: one. Management included manual detorsion without any

further procedure: five, bowel Anacetrapib resection: nine, colostomy: five, ileostomy: one. Two children passed away (respiratory infection and aspiration). Transverse colon volvulus was found to be in a clockwise direction in six cases, and anticlockwise direction in three. The remaining cases had no documentation to the direction of volvulus. Table 1 Cases of pediatric transverse colon volvulus in the literature [2, 3, 5, 8, 9] No. Author (et al) Year Age Sex Poziotinib Presentation Past medical history Degree and direction of rotation Management 1 Massot 1965 2 F distension nil 360° anti- clockwise Detorsion 2 Cuderman 1971 10 F vomiting distension mental retardation, chronic constipation clockwise Colectomy, double barrel colostomy 3 Howell 1976 4 F vomiting distension chronic constipation anti- clockwise Detorsion, mesocolon resection, colostomy 4 Howell 1976 16 F vomiting constipation distension recurrent episodes N/A Transverse colon resection, colostomy 5 Eisenstat 1977 15 F vomiting distension mental retardation N/A Resection, colostomy. Aspirated: died 4th day post operative 6 Dadoo 1977 12 M constipation distension recent severe diarrhoea 360° anti- clockwise Detorsion.

PubMed 12. Singh RP, Sharma G, Mallikarjuna GU, Dhanalakshmi S, Agarwal C, Agarwal R: In vivo suppression of hormone-refractory prostate cancer find more growth by inositol hexaphosphate: induction of insulin-like growth factor binding protein-3 and inhibition of vascular endothelial growth factor. Clin Cancer Res 2004, 10:244–250.PubMedCrossRef 13. Raina K, Rajamanickam S, Singh RP, Agarwal R: Chemopreventive efficacy of inositol

hexaphosphate against prostate tumor growth and progression in TRAMP mice. Clin Cancer Res 3184, 14:3177–2008.CrossRef 14. Ishikawa T, Nakatsuru Y, Zarkovic M, Shamsuddin AM: Inhibition of skin cancer by IP 6 in vivo: initiation-promotion model. Anticancer Res 3752, 19:3749–1999. 15. Tantivejkul K, Vucenik I, Eiseman J, Shamsuddin AM: Inositol hexaphosphate (IP 6 ) enhances the antiproliferative effects of adriamycin and tamoxifen in breast cancer.

Breast Cancer Res Treat 2003, 79:301–312.PubMedCrossRef 16. Juricic J, Druzijanic N, Perko Z, Kraljevic D, Ilic N: IP 6 + Inositol in treatment of ductal invasive breast carcinoma: our clinical experience. Anticancer Res 2004, 24:3475. 17. Sakamoto K, Suzuki Y: IP 6 plus Inositol treatment after surgery and post-operative radiotherapy: report of a case: breast cancer. Anticancer Res 2004, 24:3617. 18. Druzijanic N, Juricic J, Perko Z, Kraljevic D: IP 6 + Inositol as adjuvant to chemotherapy of colon cancer: our clinical experience. Anticancer Res 2004, 24:3474. 19. Aaronson NK, Ahmedzai S, Bergman B, Bullinger M, Cull A, Duez NJ, Filiberti A, Flechtner H, Fleishman SB, de Haes JC, Kaasa

FHPI ic50 S, Klee MC, Osoba D, Razavi D, Rofe PB, Schraub S, Sneeuw KC, Sullivan M, Takeda F: The Europen Mocetinostat manufacturer Organisation for Research and Treatment of Cancer QLQ-C30: A quality-of-life instrument for use in international clinical trials in oncology. J Natl Cancer Inst 1993, 85:365–376.PubMedCrossRef 20. Fayers PM, Aaronson NK, Bjordal K, Groenvold M, Curran D, Bottomley A, on behalf of the EORTC Quality of Life Group: The EORTC QLQ-C30 Scoring Manual. 3rd edition. European Organisation for Research and Treatment of Cancer, Brussels; 2001. 21. Lam S, McWilliams A, leRiche J, MacAulay C, Wattenberg L, Szabo E: A phase I study of myo-inositol for lung cancer chemoprevention. Cancer Epidemiol Farnesyltransferase Biomarkers Prev 1531, 15:1526–2006.CrossRef 22. Weitberg AB: A phase I/II trial of beta-(1,3)/(1,6) D-glucan in the treatment of patients with advanced malignancies receiving chemotherapy. J Exp Clin Cancer Res 2008, 27:40.PubMedCrossRef Competing interests The authors declare that they have no competing interests. Authors’ contributions IB formulated the research protocol and carried out the follow up of participants. ND and SJ participated in the design of the study and performed the statistical analysis. RK and IS participated in the design of the study, and the execution of the study protocol. All authors read and approved the final manuscript.

citri the ‘Hrp pilus’ structure per se, or its interaction with a solid surface, stabilizes the outer membrane structure, hence the lack of T3SS may trigger membrane remodeling itself. These membrane modifications in turn may change the pattern of protein expression, leading to the impairment of cellular processes directly related to bacterial virulence including biofilm formation. Another possibility is that the ‘Hrp pilus’ may function like an attachment device or flagellum.

Future studies are likely to add further insights into the exact role and modes of operation of X. citri ‘Hrp pilus’ in biofilm formation and motility. Conclusions This work demonstrates that the presence of T3SS in X. citri, besides its participation in the secretion of effector proteins is also required for biofilm formation, motility and survival Idasanutlin research buy on leaf tissue revealing novel functions check details for this secretion system in X. citri. In biofilm formation, T3SS may have an important role in modulating adaptive changes that lead to this process. Some of these changes are revealed by variations in proteins involved in metabolic processes, energy generation, EPS production and bacterial motility as well as in outer membrane proteins between the wild type strain and the T3SS

mutant. In summary, the present study reveals novel contributions of this protein secretion system to bacterial virulence. Methods Bacterial strains, culture conditions and media X. citri strain Xac99-1330 was isolated from C. sinensis and kindly provided by Blanca I. Canteros (INTA Bella Vista, Argentina). The hrpB − mutant was constructed in previous work [19]. Here, hrpB −c complemented strain was constructed by cloning the region from

hrpB5 to hrcT in the replicative plasmid pBBR1MCS-5 [20] under the control of the lacZ promoter. This region was amplified from X. citri genomic DNA with the oligonucleotides: HrpB5F-Hind Dichloromethane dehalogenase (5′ ATAGAAGCTTCATGCGTCTCTGGTTGAGGTC 3′) and HrcTR-Bam (5′ ATCAGGATCCTCAGTGCGACGCGGCTCTCT 3′) and cloned into pBBR1MCS-5 previously digested with the restriction enzymes HindIII and BamHI. The HIF inhibitor resulting construction was electroporated into the hrpB − strain and the complemented mutant strain was selected by for gentamicin antibiotic resistance. For confocal laser scanning microscopy analyses, a GFP-expressing hrpB − strain was obtained. To this end, the coding sequence for EGFP from the broad-host-range vector pBBR1MCS-2EGFP [16] was digested with BamHI and XbaI and ligated in frame with the LacZ-α-peptide of the pBBR1MCS-5 vector [20] previously digested with the same enzymes, rendering the plasmid pBBR1MCS-5EGFP. E. coli S17-1 cells transformed with this plasmid were conjugated with the hrpB − strain and the cells carrying the plasmid pBBR1MCS-5EGFP were selected for Gm resistance. All strains were grown at 28°C in Silva Buddenhagen (SB) medium [16] or in XVM2 medium [49].

All size devices have shown self-compliance bipolar switching with small set/rest voltage of -1.0/2.0 V. The switching current of 50 × 50 μm2 device was >200 μA and for 30 × 30 nm2 device was approximately 40 μA, respectively (Figure 10d). From the I-V switching curves, this is a symmetric current profile when the device is in the LRS, but it is an asymmetric current profile for the HRS. This property was exploited to realize RRAM devices in crossbar architecture without any selection device with anti-serial

connection. They were also able to achieve the highest ever reported endurance value of 1012 for this system at 30 × 30 μm2 cell size for base layer oxidation of 3%. Data retention of >10 years at 85°C was also reported. To eliminate the need for a discrete switch element such as a diode or transistor, they connected two Pt/Ta2O5-x /TaO2-x /Pt cells antiserially by external contacts and this concept was also reported selleckchem by Linn et al. [134]. Figure 9 Program/erase endurance. Endurance comparison

of (a) TiO x and (b) TaO x devices [110]. Figure 10 Schematic of switching mechanism Veliparib datasheet and I-V characteristics of cross-point memory devices. (a) Schematic representation of the TaO x device consisting of a thin Ta2O5-x insulating layer and a TaO2-x base layer. The movement of internal oxygen ions or vacancies is used to model the switching. (b) SEM image of a 30-nm crossbar array of devices with the inset showing a single device. (c) TEM cross-section of a 30-nm crossbar cell. The total thickness of TaO x layer is 30 nm. (d) I-V hysteresis characteristics [31]. Wei et al. [109] explored first the prospective application of TaO x -based RRAM devices. The memory stack consisted of Pt top and bottom electrodes and a non-stoichiometric switching layer of TaO x . The first layer near the TE is close to

insulating Ta2O5-x phase, while the other layer is close to TaO2-x phase which is conducting. The memory device with a size of 0.5 × 0.5 μm2 in 1T1R configuration showed bipolar switching characteristics under an operation current of approximately 170 μA. The device shows excellent P/E endurance of >109 cycles. The data Morin Hydrate retention property could be improved under low-current operation by controlling the size of the conductive filament as well as percolation paths, while the density of oxygen vacancy is kept high enough. It is true that the conducting filament size can be scaled down by reducing both the forming current and formation. A forming voltage can be decreased with a thinner switching layer. However, the thinnest layer is not required because this will have lower HRS. Figure 11a shows a pulsed R-V curve of the two-step forming to control the formation of conducting filament size in Ir/Ta2O5-δ /TaO x resistive memory stack [120]. At first (or step 1), a www.selleckchem.com/products/cx-5461.html positive pulse that has the same polarity for the RESET is applied to generate oxygen vacancies in the Ta2O5-δ layer, as shown in Figure 11b.